Graph Parabola Calculator

Parabola Form: Standard: y = ax² + bx + cVertex: y = a(x – h)² + k Coefficient a: Coefficient b: Coefficient c: Coefficient a: Vertex h (x-coordinate): Vertex k (y-coordinate): Calculate Reset Parabola Properties: A Graph Parabola Calculator is an essential online math tool that helps students, teachers, engineers, and mathematics enthusiasts visualize and … Read more

 Gc Calculator 

DNA/RNA Sequence: ATCGGCTAGCTAGCGCGATATCGGCCGTAGC Sequence Type: DNARNA Analysis Options: Calculate Melting Temperature Show Complementary Strand Calculate Reset Analysis Results: A GC Calculator is a practical online tool designed to help users calculate GC values quickly and accurately without performing lengthy manual calculations. Depending on the field of use, GC may refer to different measurements, but in … Read more

Gallon To Liter Calculator

Conversion Direction: Gallons to LitersLiters to Gallons Gallon Type: US GallonImperial Gallon (UK) Enter Gallons: Calculate Reset Conversion Result: A Gallon To Liter Calculator is a simple and accurate online tool designed to convert gallons into liters within seconds. Whether you are measuring fuel, water, milk, chemicals, or any other liquid, converting between gallons and … Read more

Fish Tank Stocking Calculator 

Tank Length (inches): Tank Width (inches): Tank Height (inches): Water Type: FreshwaterSaltwaterReef Filtration Quality: BasicStandardAdvanced (Canister/Sump) Average Fish Size (inches): Calculate Reset Stocking Capacity: A healthy aquarium begins with proper planning, and one of the most important aspects of aquarium care is avoiding overcrowding. Too many fish in a tank can lead to poor water … Read more

Fish Stocking Calculator

Pond/Lake Surface Area (acres): Average Depth (feet): Water Quality: Excellent (High Oxygen, Clean)Good (Normal Conditions)Fair (Some Issues)Poor (Limited Oxygen) Primary Fish Type: BassBluegillCatfishTroutCarpMixed Species Management Goal: Trophy Fish (Low Density)Balanced PopulationHigh Harvest (High Density) Calculate Reset Stocking Recommendations: A Fish Stocking Calculator is a practical tool that helps pond owners, aquarium hobbyists, and fish farmers … Read more

Fire Movement Calculator

Fire Type: Grassland FireForest FireWildland FireUrban Fire Wind Speed (km/h): Slope Angle (degrees): Fuel Moisture (%): Temperature (°C): Calculate Reset Fire Spread Prediction: Wildfires and controlled fires can spread rapidly depending on weather, terrain, vegetation, and other environmental conditions. Estimating how a fire is likely to move is essential for firefighters, emergency responders, forestry professionals, … Read more

Fetal Percentile Calculator

Gestational Age (weeks): Measurement Type: Estimated Fetal Weight (g)Biparietal Diameter (mm)Head Circumference (mm)Abdominal Circumference (mm)Femur Length (mm) Measurement Value: Calculate Reset Percentile Analysis: Pregnancy is an exciting journey, and monitoring your baby’s growth is one of the most important aspects of prenatal care. A Fetal Percentile Calculator is a helpful online tool designed to estimate … Read more